Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-215-5p 억제를 위한 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 디자인을 적용해 강력한 억제 효과 제공. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적 억제 유지. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-215-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, and co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달 가능
- 반복 형질감염 없이 장기적 억제 유지 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUGACCUAUGAUUUGACAGAC |
| Sanger 성숙/소수 수납 번호 | MIMAT0000904 |
| microRNA 수납 번호 | MI0000974 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.