
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-1195를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적이고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 높은 전달 효율. 퓨로마이신 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-1195
- 형태: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태(Form) | Liquid |
| 농도(Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열(Mature Sequence) | UGAGUUCGAGGCCAGCCUGCUCA |
| Sanger 성숙/소수 수납 번호 | MIMAT0005856 |
| microRNA 수납 번호 | MI0006303 |
| 배송 상태(Shipping Condition) | Dry ice |
| 저장 온도(Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달로 다양한 세포 유형에 효율적 도입
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



