
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 MISSION® Lenti microRNA Inhibitor. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포주에 효율적 전달 가능. 장기적인 miRNA 억제 유지. 퓨로마이신 내성 유전자로 세포 선택 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-669f-3p
Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CAUAUACAUACACACACACGUAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0005839 |
| microRNA 수납 번호 | MI0006287 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for effective miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included to enhance transgene expression.
This vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral delivery로 다양한 세포 유형에 효율적 전달
- 반복 형질감염 없이 장기적인 억제 가능
- 퓨로마이신 내성 유전자를 통한 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



