Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-493-3p

설계 방식

• Tough Decoy (TuD) 구조를 이용한 miRNA 억제 설계

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGAAGGUCCUACUGUGUGCCAGG

Sanger 성숙/소수 수납 번호

• MIMAT0004888

microRNA 수납 번호

• MI0005514

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids generates viral particles for mammalian cell transduction.
The vector includes WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression and a puromycin resistance gene for selection.

주요 특징

• 강력한 miRNA 억제 효과 제공
• 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달 가능
• 반복적인 트랜스펙션 없이 장기적 억제 유지 가능
• 퓨로마이신 저항성 유전자로 세포 선택 가능