Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 렌티바이러스 기반 microRNA 억제제로, Tough Decoy(TuD) 디자인을 적용하여 강력한 miRNA 억제 효과 제공. 다양한 세포 유형에 효율적으로 전달되며, 장기적 억제 가능. Puromycin 선택 마커 및 WPRE 포함으로 발현 효율 향상.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-466g
Design: Tough Decoy (TuD)
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AUACAGACACAUGCACACACA |
| Sanger 성숙/소수 수납 번호 | MIMAT0004883 |
| microRNA 수납 번호 | MI0005510 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T, et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective miRNA inhibition.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles that can transduce mammalian cells efficiently.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance transgene expression.
The lentiviral vector carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- Puromycin 선택 마커 및 WPRE 포함으로 발현 효율 향상
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.