
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 다양한 세포에서 효율적 전달 가능. Tough Decoy(TuD) 디자인을 적용하여 강력한 miRNA 억제 효과 제공. 장기적 억제 유지 및 퓨로마이신 내성 선택 가능. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD0766
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-466b-5p
Design Type
Tough Decoy (TuD)
품질 등급
200 (M-Clarity Program)
제품 라인
MISSION®
제품 형태 및 사양
| 항목 | 내용 |
|---|---|
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGAUGUGUGUGUACAUGUACAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0004875 |
| microRNA 수납 번호 | MI0005502, MI0005503, MI0005504, MI0014060, MI0014063, MI0014067, MI0014070, MI0014112 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm employs the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids enables production of viral particles suitable for transduction of mammalian cells.
The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral 포맷으로 다양한 세포 유형에 효율적 전달
- 반복적인 transfection 없이 장기간 억제 가능
- 퓨로마이신 내성 유전자 포함으로 선택 용이
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



