Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-450b-5p

디자인

• Tough Decoy (TuD) 형식

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UUUUGCAGUAUGUUCCUGAAUA

Sanger 성숙/소수 수납 번호

• MIMAT0003511

microRNA 수납 번호

• MI0004705

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables production of viral particles for transduction into mammalian cells.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selective cell screening

주요 특징

• 강력한 miRNA 억제 가능
• Lentiviral 전달 형식으로 다양한 세포에 효율적 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• 선택적 세포 선별을 위한 puromycin 저항성 유전자 포함