
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-505-3p 억제를 위한 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 설계를 통해 강력하고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 효율적으로 전달되며, 퓨로마이신 저항성 유전자를 포함합니다. −70°C에서 건빙 상태로 배송됩니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-505-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
- 퓨로마이신 저항성 유전자 포함
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CGUCAACACUUGCUGGUUUUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003513 |
| microRNA 수납 번호 | MI0004706 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
참고 정보
- Designed using proprietary algorithm from Haraguchi et al.
- Lentiviral vector: TRC2-pLKO-puro with WPRE and puromycin resistance gene.
- Suitable for stable, long-term inhibition of miRNA in mammalian cells.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



