
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 유래 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계 제품. 다양한 세포주에 효율적으로 전달 가능하며, 장기적 억제 효과 제공. −70°C 보관, 드라이아이스 배송. 품질 수준 200, 농도 ≥1x10⁶ VP/ml.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-5623-3p
설계 방식
- Tough Decoy (TuD) 기반
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of the target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction of mammalian cells.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression, and the vector includes a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into various cell types
- Long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GUUCUGGCUUUCAGCUGUCACC |
| Sanger 성숙/소수 수납 번호 | MIMAT0022374 |
| microRNA 수납 번호 | MI0019191 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



