Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-5622-3p

디자인 유형

• Tough Decoy (TuD)

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

제품 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CUUAGCUGGGUAGUGGUGGUGC

Sanger 성숙/소수 수납 번호

• MIMAT0022372

microRNA 수납 번호

• MI0019190

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al. This algorithm employs the Tough Decoy (TuD) design for potent miRNA inhibition.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 기능 제공
• 다양한 세포 유형에 효율적으로 전달 가능
• 반복적인 트랜스펙션 없이 장기적 억제 가능