Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-669b-3p

디자인

• Tough Decoy (TuD) 형식

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CAUAUACAUACACACAAACAUAU

Sanger 성숙/소수 수납 번호

• MIMAT0017250

microRNA 수납 번호

• MI0004666

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific microRNAs.

microRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of stable cell lines.

주요 특징

• 강력한 miRNA 억제 효과
• 렌티바이러스 전달로 다양한 세포에 효율적 도입 가능
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• Puromycin 저항성 유전자로 안정적 세포주 선택 가능