
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용 TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 효율적 전달 가능 Puromycin 선택 마커 포함으로 안정적 세포주 구축 가능 장기적인 miRNA 억제 효과 제공 −70°C 보관, 드라이아이스 배송
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-669b-3p
디자인
- Tough Decoy (TuD) 형식
품질 등급
- 200
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- CAUAUACAUACACACAAACAUAU
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific microRNAs.
microRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of stable cell lines.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달로 다양한 세포에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- Puromycin 저항성 유전자로 안정적 세포주 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



