Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 포맷 제품. 효율적인 세포 전달 및 장기적 miRNA 억제 가능. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 내성 유전자 포함. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-449c-5p
Format
Tough Decoy (TuD)
제품 라인
MISSION®
품질 등급
200
제품 사양
| 항목 | 내용 |
|---|---|
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AGGCAGUGCAUUGCUAGCUGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0003460 |
| microRNA 수납 번호 | MI0004645 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력하고 특정 miRNA에 대한 효율적 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 적용 가능
- 반복적인 트랜스펙션 없이 장기적 억제 효과 유지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.