CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 miRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 인히비터. 효율적인 세포 전달 및 장기적 억제 가능. 고품질 MISSION® 라인 제품으로 −70°C 보관. 퓨로마이신 선택 마커 포함.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0589 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-3099-3p

Tough Decoy (TuD)


제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) UAGGCUAGAGAGAGGUUGGGGA
Sanger 성숙/소수 수납 번호 MIMAT0014816
microRNA 수납 번호 MI0004485
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.


주요 특징

  • 강력한 miRNA 억제 기능 제공
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달 가능
  • 반복 형질감염 없이 장기적 억제 효과 유지
  • 퓨로마이신 내성 유전자로 세포 선택 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.