Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-367-5p
• 형태: Tough Decoy (TuD)

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• ACUGUUGCUAACAUGCAACUC

Sanger 성숙/소수 수납 번호

• MIMAT0017214

microRNA 수납 번호

• MI0003531

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
• Puromycin resistance gene for selection of transduced cells

Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

주요 특징

• 강력한 miRNA 억제 효과
• Lentiviral 형식으로 다양한 세포에 효율적 전달
• 반복적인 트랜스펙션 없이 장기 억제 가능