
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-489-3p를 대상으로 하는 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 디자인을 사용하여 강력하고 지속적인 miRNA 억제를 제공합니다. 다양한 세포주에 효율적으로 전달 가능하며, 퓨로마이신 저항성 유전자를 포함합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-489-3p
디자인
- Tough Decoy (TuD)
제품 라인
- MISSION®
품질 등급
- 200 (M-Clarity Program)
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- AAUGACACCACAUAUAUGGCAGC
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포주에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



