Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA 억제제는 Tough Decoy(TuD) 설계를 기반으로 강력한 miRNA 억제를 제공합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 장기간 억제 효과를 유지합니다. 퓨로마이신 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5113
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to enable potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 가능
- 렌티바이러스 기반 전달로 다양한 세포에 효율적 도입
- 반복적인 형질감염 없이 장기간 억제 유지
- 퓨로마이신 저항성 유전자 포함
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACAGAGGAGGAGAGAGAUCCUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0020621 |
| microRNA 수납 번호 | MI0018022 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(본 상품 관련 이미지는 아래에 배치됩니다)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.