
Merck MISSION Lenti microRNA Inhibitor, Mouse
강력한 microRNA 억제 기능 제공. Lentiviral 전달로 다양한 세포에 효율적 적용 가능. 장기적인 miRNA 억제 유지. Puromycin 저항성 유전자로 선택 가능. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5101
Tough Decoy (TuD) 형식
품질 등급
200
제품 라인
MISSION®
형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
UUUGUUUGUUUUGCUGAUGCAG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
Dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 목표 miRNA 억제 가능
- Lentiviral 전달 포맷으로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적인 억제 유지
- Puromycin 저항성 유전자를 통한 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



