Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 효율적으로 억제하는 렌티바이러스 기반 TuD 디자인 제품입니다. 다양한 세포에 안정적으로 전달 가능하며 장기적인 억제 효과를 제공합니다. 퓨로마이신 저항성 유전자 포함, −70°C에서 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3966
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 효과
- 퓨로마이신 저항성 유전자 포함
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGCUGCCAGCUGUAGAACUGU |
| 성숙/소수 수납 번호 (Sanger) | MIMAT0019350 |
| microRNA 수납 번호 | MI0016975 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.