
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-374c-5p 억제를 위한 Tough Decoy(TuD) 디자인 기반 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 가능. 장기적인 miRNA 억제 효과 제공. −70°C에서 보관, 드라이아이스 배송.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-374c-5p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into a wide range of cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUAAUACAACCUGCUAAGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0014953 |
| microRNA 수납 번호 | MI0014108 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|