
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-374c-5p 억제를 위한 Tough Decoy(TuD) 디자인 기반 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 가능. 장기적인 miRNA 억제 효과 제공. −70°C에서 보관, 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-374c-5p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into a wide range of cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUAAUACAACCUGCUAAGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0014953 |
| microRNA 수납 번호 | MI0014108 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



