Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 렌티바이러스 기반 microRNA 억제제 TuD(Tough Decoy) 디자인으로 강력한 miRNA 억제 가능 다양한 세포에 효율적으로 전달 및 장기적 억제 유지 TRC2-pLKO-puro 벡터 기반, 퓨로마이신 내성 유전자 포함 −70°C에서 건빙 상태로 배송 및 보관
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-384-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables viral particle production for transduction into mammalian cells.
The vector includes WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUUCCUAGAAAUUGUUCACAAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0001076 |
| microRNA 수납 번호 | MI0001146 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 정보는 본문 하단에 위치하며, 원본 이미지는 유지됩니다.)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.