CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-381-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적인 세포 전달과 장기적 억제 가능. puromycin 선택 마커 및 WPRE 포함으로 높은 발현 효율 제공.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
Merck MLTUD0418 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-381-5p

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to inhibit specific miRNA activity.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

Key Advantages:

  • Potent inhibition of target miRNA
  • Efficient lentiviral delivery to diverse cell types
  • Long-term inhibition without repeated transfection

제품 사양

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AGCGAGGUUGCCCUUUGUAUAUU
Sanger 성숙/소수 수납 번호 MIMAT0017081
microRNA 수납 번호 MI0000798
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.