Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-362-5p

디자인

• Tough Decoy (TuD) 기반 설계

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AAUCCUUGGAACCUAGGUGUGAAU

miRNA 등록 정보

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 효과
• 다양한 세포 유형에 효율적 렌티바이러스 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• 푸로마이신 저항성 유전자 포함