Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하도록 설계된 렌티바이러스 기반 TuD 포맷 제품입니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 반복적인 트랜스펙션 없이 장기적인 억제가 가능합니다. −70°C에서 건빙 상태로 배송됩니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
타겟 microRNA
- mmu-miR-181c-3p
디자인 형식
- Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection into the appropriate cell line with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression.
This vector also carries a puromycin resistance gene for selection.
주요 특징
- Potent inhibition of target miRNA
- Lentiviral delivery enables efficient transduction across cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACCAUCGACCGUUGAGUGGACC |
| Sanger 성숙/소수 수납 번호 | MIMAT0017068 |
| microRNA 수납 번호 | MI0000724 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.