CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하도록 설계된 렌티바이러스 기반 TuD 포맷 제품입니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 반복적인 트랜스펙션 없이 장기적인 억제가 가능합니다. −70°C에서 건빙 상태로 배송됩니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
Merck MLTUD0381 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

타겟 microRNA

  • mmu-miR-181c-3p

디자인 형식

  • Tough Decoy (TuD)

제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection into the appropriate cell line with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression.
This vector also carries a puromycin resistance gene for selection.

주요 특징

  • Potent inhibition of target miRNA
  • Lentiviral delivery enables efficient transduction across cell types
  • Long-term inhibition without repeat transfection

제품 스펙

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 ACCAUCGACCGUUGAGUGGACC
Sanger 성숙/소수 수납 번호 MIMAT0017068
microRNA 수납 번호 MI0000724
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.