Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 설계 기반의 렌티바이러스 miRNA 억제제. 다양한 세포 유형에 효율적으로 전달 가능. 장기적인 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자를 포함하여 세포 선택 가능. −70°C에서 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-199b-5p
Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CCCAGUGUUUAGACUACCUGUUC |
| Sanger 성숙/소수 수납 번호 | MIMAT0000672 |
| microRNA 수납 번호 | MI0000714 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids generates viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression and a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달
- 반복 형질감염 없이 장기적인 억제 가능
- 퓨로마이신 내성 유전자를 포함하여 세포 선택 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.