Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-211-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적인 렌티바이러스 전달로 다양한 세포에 적용 가능. 장기간 miRNA 억제 유지 및 퓨로마이신 선택 가능. −70°C 보관, 드라이아이스 배송.

카탈로그번호: MLTUD0349
브랜드: Merck Sigma
카테고리: Merck
판매단위: pk

#Merck #Sigma #Merck Sigma

카탈로그

1개 옵션

회원가입 없이 바로 구매하세요

가입하지 않아도 비회원가로 구매하실 수 있습니다.

마지막 업데이트 2026. 01. 28. 오후 05:39

카탈로그 번호 · 상품 설명출고판매가담기

Merck MLTUD0349 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·

재고 확인 필요재고 확인 필요

716,600원VAT 포함 788,260원

재고문의·견적요청 옵션은 실시간 상담으로 납기를 확인해 드립니다 · 연구비 카드 결제 가능

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

mmu-miR-211-5p

디자인

Tough Decoy (TuD) 구조 기반

제품 라인

MISSION®

품질 등급

형태

Liquid

농도

≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

UUCCCUUUGUCAUCCUUUGCCU

항목	등록 번호	링크
성숙/소수 수납 번호	MIMAT0000668	mirBase 링크
microRNA 수납 번호	MI0000708	mirBase 링크

배송 및 보관

항목	조건
배송 상태	Dry ice
저장 온도	−70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
The vector also includes a puromycin resistance gene for selection of successfully transduced cells.