CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-211-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적인 렌티바이러스 전달로 다양한 세포에 적용 가능. 장기간 miRNA 억제 유지 및 퓨로마이신 선택 가능. −70°C 보관, 드라이아이스 배송.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
Merck MLTUD0349 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

  • mmu-miR-211-5p

디자인

  • Tough Decoy (TuD) 구조 기반

제품 라인

  • MISSION®

품질 등급

  • 200

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • UUCCCUUUGUCAUCCUUUGCCU

관련 등록 번호

항목 등록 번호 링크
성숙/소수 수납 번호 MIMAT0000668 mirBase 링크
microRNA 수납 번호 MI0000708 mirBase 링크

배송 및 보관

항목 조건
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
The vector also includes a puromycin resistance gene for selection of successfully transduced cells.


주요 특징

  • 강력한 miRNA 억제 효과
  • 다양한 세포에 효율적인 렌티바이러스 전달 가능
  • 반복적인 트랜스펙션 없이 장기간 억제 유지
  • 퓨로마이신 선택 마커 포함

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.