Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-218-1-3p

설계 방식

• Tough Decoy (TuD) 기반 설계

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AAACAUGGUUCCGUCAAGCACC

Sanger 성숙/소수 수납 번호

• MIMAT0004665

microRNA 수납 번호

• MI0000700

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for effective inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids enables production of viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.

주요 특징

• 강력한 miRNA 억제 효과
• 다양한 세포형에 효율적 렌티바이러스 전달
• 반복적 형질감염 없이 장기적 억제 유지
• 퓨로마이신 선택 마커 포함