
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-218-1-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포형에 효율적 전달 가능. 장기적 억제 유지 및 퓨로마이신 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-218-1-3p
설계 방식
- Tough Decoy (TuD) 기반 설계
제품 라인
- MISSION®
품질 등급
- 200
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- AAACAUGGUUCCGUCAAGCACC
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for effective inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids enables production of viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포형에 효율적 렌티바이러스 전달
- 반복적 형질감염 없이 장기적 억제 유지
- 퓨로마이신 선택 마커 포함
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



