
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 miRNA 억제제로 다양한 세포에 효율적 전달 가능 TuD(Tough Decoy) 디자인으로 강력하고 지속적인 miRNA 억제 제공 Puromycin 내성 유전자를 포함해 선택적 세포 선별 가능 건조 얼음 배송, −70°C 저장 조건 유지
- 카탈로그번호
- MLTUD0300
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-101b-3p
디자인
- Tough Decoy (TuD) 구조 적용
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UACAGUACUGUGAUAGCUGAA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed in collaboration with Dr. Hideo Iba (University of Tokyo) and based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows viral particle production upon co-transfection with packaging plasmids.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral 전달 포맷으로 다양한 세포에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- Puromycin 내성 유전자를 통한 선택적 세포 선별 지원
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



