Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-101b-3p

디자인

• Tough Decoy (TuD) 구조 적용

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UACAGUACUGUGAUAGCUGAA

Sanger 성숙/소수 수납 번호

• MIMAT0000616

microRNA 수납 번호

• MI0000649

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed in collaboration with Dr. Hideo Iba (University of Tokyo) and based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows viral particle production upon co-transfection with packaging plasmids.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.

주요 특징

• 강력한 miRNA 억제 효과 제공
• Lentiviral 전달 포맷으로 다양한 세포에 효율적 도입 가능
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• Puromycin 내성 유전자를 통한 선택적 세포 선별 지원