CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-350-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제입니다. 효율적이고 지속적인 miRNA 억제가 가능하며, 다양한 세포형에 안정적으로 전달됩니다. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 선택이 가능합니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0295 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-350-3p

Inhibitor Type

  • Tough Decoy (TuD)

Quality Level

Product Line

  • MISSION®

Form

  • Liquid

Concentration

  • ≥ 1×10⁶ VP/ml (via p24 assay)

Mature Sequence

  • UUCACAAAGCCCAUACACUUUC

Sanger Mature/Minor Accession Number

microRNA Accession Number

Shipping Conditions

  • Dry ice

Storage Temperature

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, based on the work of Haraguchi et al.
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
  • Puromycin resistance gene for cell selection

Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.


주요 특징

  • 강력한 miRNA 억제 효과
  • 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기 억제 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.