Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-350-3p

Inhibitor Type

• Tough Decoy (TuD)

Quality Level

• 200 (M-Clarity Program)

Product Line

• MISSION®

Form

• Liquid

Concentration

• ≥ 1×10⁶ VP/ml (via p24 assay)

Mature Sequence

• UUCACAAAGCCCAUACACUUUC

Sanger Mature/Minor Accession Number

• MIMAT0000605

microRNA Accession Number

• MI0000640

Shipping Conditions

• Dry ice

Storage Temperature

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, based on the work of Haraguchi et al.
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
• Puromycin resistance gene for cell selection

Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

주요 특징

• 강력한 miRNA 억제 효과
• 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
• 반복적인 트랜스펙션 없이 장기 억제 가능