
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA 억제제는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 시스템으로 효율적인 miRNA 억제 제공. TRC2-pLKO-puro 벡터 사용으로 다양한 세포에 안정적 전달 가능. puromycin 선택마커 포함으로 장기 억제 유지 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-337-5p
Type: Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
- 반복적인 트랜스펙션 없이 장기 억제 가능
- puromycin 저항성 유전자로 선택 용이
스펙 정보
| 항목 | 내용 |
|---|---|
| 제품 라인 | MISSION® |
| 품질 등급 | 200 |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GAACGGCGUCAUGCAGGAGUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0004644 |
| microRNA 수납 번호 | MI0000615 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



