Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 렌티바이러스 기반 microRNA 억제제로, 특정 miRNA를 강력하게 억제합니다. Tough Decoy(TuD) 설계를 적용하여 안정적이고 효율적인 억제 효과를 제공합니다. 다양한 세포주에 적용 가능하며, 장기적 억제 효과를 유지합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.
- 카탈로그번호
- MLTUD0216
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-18a-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed in collaboration with Dr. Hideo Iba (University of Tokyo) and based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design to achieve potent and stable inhibition of target miRNA.
miRNAs regulate gene expression via mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력하고 지속적인 miRNA 억제 효과
- 다양한 세포 유형에서 효율적인 렌티바이러스 전달
- 반복 형질감염 없이 장기적 억제 가능
- puromycin 내성 유전자를 통한 세포 선택 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| Product Line | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | ACUGCCCUAAGUGCUCCUUCUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004626 |
| microRNA 수납 번호 | MI0000567 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.