CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 렌티바이러스 기반 microRNA 억제제로, 특정 miRNA를 강력하게 억제합니다. Tough Decoy(TuD) 설계를 적용하여 안정적이고 효율적인 억제 효과를 제공합니다. 다양한 세포주에 적용 가능하며, 장기적 억제 효과를 유지합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.

카탈로그번호
MLTUD0216
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0216 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-18a-3p

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed in collaboration with Dr. Hideo Iba (University of Tokyo) and based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design to achieve potent and stable inhibition of target miRNA.

miRNAs regulate gene expression via mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.


주요 특징

  • 강력하고 지속적인 miRNA 억제 효과
  • 다양한 세포 유형에서 효율적인 렌티바이러스 전달
  • 반복 형질감염 없이 장기적 억제 가능
  • puromycin 내성 유전자를 통한 세포 선택 가능

제품 사양

항목 내용
Quality Level 200
Product Line MISSION®
Form Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) ACUGCCCUAAGUGCUCCUUCUG
Sanger 성숙/소수 수납 번호 MIMAT0004626
microRNA 수납 번호 MI0000567
배송 상태 Dry Ice
저장 온도 −70°C

참고 문헌

Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.