
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-130b-5p에 특이적인 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 효과를 제공합니다. 다양한 세포에 효율적으로 전달되며, 장기적인 억제 유지가 가능합니다. −70°C에서 건빙 상태로 보관합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-130b-5p
디자인
- Tough Decoy (TuD) 형식
제품 라인
- MISSION®
품질 등급
- 200 (M-Clarity Program)
제품 형태 및 특성
| 항목 | 내용 |
|---|---|
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACUCUUUCCCUGUUGCACUACU |
| Sanger 성숙/소수 수납 번호 | MIMAT0004583 |
| microRNA 수납 번호 | MI0000408 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
MicroRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



