
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA Inhibitor, Mouse
상품 한눈에 보기
마우스 mmu-miR-433-3p 억제를 위한 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 설계로 강력한 miRNA 억제 가능. 다양한 세포에 효율적 전달 및 장기적 억제 유지. 퓨로마이신 저항성 유전자 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
카탈로그 번호 · 상품 설명출고판매가담기
ADADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기Merck MLTUD0454 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원
Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-433-3p
설계 방식
- Tough Decoy (TuD) 구조 기반
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUCAUGAUGGGCUCCUCGGUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0001420 |
| microRNA 수납 번호 | MI0001525 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA activity.
miRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which can be co-transfected with packaging plasmids to produce viral particles for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for stable selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



