
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA의 강력하고 지속적인 억제를 가능하게 합니다. Tough Decoy(TuD) 설계를 기반으로 하며, 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 전달됩니다. TRC2-pLKO-puro 벡터와 퓨로마이신 저항 유전자를 포함하여 안정적 발현이 가능합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-409-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- Potent inhibition of desired miRNA
- Efficient delivery via lentiviral format
- Enables long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GAAUGUUGCUCGGUGAACCCCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0001090 |
| microRNA 수납 번호 | MI0001160 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



