CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 강력한 miRNA 억제를 제공합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달이 가능하며, 장기적인 억제 효과를 유지합니다. 퓨로마이신 저항성 유전자를 포함해 선택 배양이 용이합니다.

브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0404 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-365-1-5p

Type: Tough Decoy (TuD)


제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AGGGACUUUUGGGGGCAGAUGUG
Sanger 성숙/소수 수납 번호 MIMAT0017077
microRNA 수납 번호 MI0000768
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, based on the work of Haraguchi, T., et al. This algorithm utilizes the Tough Decoy (TuD) design.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles that can transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included for enhanced transgene expression. The lentiviral vector also carries a puromycin resistance gene, enabling selection of successfully transduced cells.


주요 특징

  • 강력한 miRNA 억제 가능
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기적 억제 유지
  • 퓨로마이신 선택 마커 포함

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.