Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-221-3p

디자인

• Tough Decoy (TuD) 형식

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AGCUACAUUGUCUGCUGGGUUUC

Sanger 성숙/소수 수납 번호

• MIMAT0000669

microRNA 수납 번호

• MI0000709

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.

주요 특징

• 강력한 miRNA 억제 효능
• 다양한 세포 유형에 효율적 렌티바이러스 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• 선택적 세포 선별을 위한 puromycin 저항성 유전자 포함