
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-218-2-3p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 효율적 전달. puromycin 선택 마커 및 WPRE 포함으로 발현 강화.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-218-2-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 적용
- 반복적인 트랜스펙션 없이 장기 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CAUGGUUCUGUCAAGCACCGCG |
| Sanger 성숙/소수 수납 번호 | MIMAT0005444 |
| microRNA 수납 번호 | MI0000701 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
적용 분야
- 유전자 발현 조절 연구
- miRNA 기능 분석
- 장기적 miRNA 억제 모델 구축
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



