
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-214-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 디자인으로 강력하고 지속적인 miRNA 억제 제공. 다양한 세포 유형에 효율적으로 전달 가능. 퓨로마이신 저항성 유전자로 선택 용이.
- 카탈로그번호
- MLTUD0330
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-214-3p
Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACAGCAGGCACAGACAGGCAGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000661 |
| microRNA 수납 번호 | MI0000698 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through mechanisms such as:
- Translational repression
- mRNA cleavage
- Deadenylation
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles that can transduce mammalian cells efficiently.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) enhances transgene expression.
The vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 기반 전달로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



