CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-210-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 효율적 전달 가능. 장기적 억제 및 퓨로마이신 선택 기능 제공.

브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0325 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-210-3p

Design Type

  • Tough Decoy (TuD)

제품 라인

  • MISSION®

품질 등급

  • 200

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • CUGUGCGUGUGACAGCGGCUGA

Sanger 성숙/소수 수납 번호

microRNA 수납 번호

  • MI0000695

배송 상태

  • Dry ice

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of cells.


주요 특징

  • Potent inhibition of the desired miRNA
  • Lentiviral delivery enables efficient transduction across various cell types
  • Long-term inhibition achievable without repeat transfection

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.