
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-210-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 효율적 전달 가능. 장기적 억제 및 퓨로마이신 선택 기능 제공.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-210-3p
Design Type
- Tough Decoy (TuD)
제품 라인
- MISSION®
품질 등급
- 200
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- CUGUGCGUGUGACAGCGGCUGA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000695
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of cells.
주요 특징
- Potent inhibition of the desired miRNA
- Lentiviral delivery enables efficient transduction across various cell types
- Long-term inhibition achievable without repeat transfection
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|