
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 TuD 디자인을 기반으로 한 강력한 miRNA 억제 벡터입니다. 렌티바이러스 전달로 다양한 세포에 효율적 도입 가능하며, 장기적 억제 효과를 제공합니다. 푸로마이신 선택 마커와 WPRE 요소 포함.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-338-5p
Tough Decoy (TuD) 디자인 기반
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 도입
- 반복적인 트랜스펙션 없이 장기적 억제 유지
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AACAAUAUCCUGGUGCUGAGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004647 |
| microRNA 수납 번호 | MI0000619 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



