
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-96-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적이고 장기적인 miRNA 억제 가능. 다양한 세포 유형에 안정적으로 전달. 퓨로마이신 선택 마커 및 WPRE 포함.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-96-5p
디자인
- Tough Decoy (TuD) 기반
제품 라인
- MISSION®
품질 등급
- 200 (M-Clarity Program)
형태 및 농도
| 항목 | 내용 |
|---|---|
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
서열 및 등록 정보
| 항목 | 내용 |
|---|---|
| 성숙 서열 | UUUGGCACUAGCACAUUUUUGCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000541 |
| microRNA 수납 번호 | MI0000583 |
배송 및 보관
| 항목 | 내용 |
|---|---|
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi et al. and developed in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm employs the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 표적 miRNA에 대한 강력한 억제 효과
- 렌티바이러스 전달을 통한 다양한 세포 유형에서 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



