
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 MISSION Lenti microRNA Inhibitor. Tough Decoy(TuD) 디자인 적용으로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적 전달 가능. 퓨로마이신 내성 유전자 포함으로 안정적 세포 선택 가능.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-23a-5p
디자인
- Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | GGGGUUCCUGGGGAUGGGAUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0017019 |
| microRNA 수납 번호 | MI0000571 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve effective inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression, and a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



