Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 디자인 기반으로 설계되어 특정 miRNA를 강력히 억제합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 장기적인 억제 효과를 제공합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.
- 카탈로그번호
- MLTUD0213
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-16-5p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UAGCAGCACGUAAAUAUUGGCG |
| Sanger 성숙/소수 수납 번호 | MIMAT0000527 |
| microRNA 수납 번호 | MI0000566 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included to enhance transgene expression.
This lentiviral vector also carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 특정 miRNA에 대한 강력한 억제 효과
- 렌티바이러스 기반 전달로 다양한 세포 유형에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적인 억제 효과 제공
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.