Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

타겟 miRNA

• mmu-let-7b-5p

설계 방식

• Tough Decoy (TuD) 기반

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGAGGUAGUAGGUUGUGUGGUU

Sanger 성숙/소수 수납 번호

• MIMAT0000522

microRNA 수납 번호

• MI0000558

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 효과
• 렌티바이러스 기반 전달로 다양한 세포 유형에 적용 가능
• 반복 트랜스펙션 없이 장기 억제 유지