Merck MISSION Lenti microRNA Inhibitor, Mouse
miRNA 발현 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 디자인 적용으로 강력한 억제 효과 제공. 다양한 세포주에 효율적으로 전달 가능. 장기적인 억제 유지 및 퓨로마이신 내성 유전자 포함.
- 카탈로그번호
- MLTUD0181
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-30d-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UGUAAACAUCCCCGACUGGAAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0000515 |
| microRNA 수납 번호 | MI0000549 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 보관 온도 (Storage Temperature) | −70 °C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent and specific inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles that can efficiently transduce mammalian cells.
The construct includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자 포함으로 세포 선택 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.