
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 Lentiviral microRNA 억제제로 강력하고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 설계 기반으로 다양한 세포에 효율적 전달. TRC2-pLKO-puro 벡터 및 puromycin 선택마커 포함. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-296-5p
Tough Decoy (TuD) 설계 기반 microRNA 억제제
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGGGCCCCCCCUCAAUCCUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000374 |
| microRNA 수납 번호 | MI0000394 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과
- Lentiviral 전달 방식으로 다양한 세포에 효율적 전달
- 반복적 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



