
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-10b-5p 억제를 위한 Tough Decoy 기반 렌티바이러스형 microRNA 억제제입니다. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 효율적 전달이 가능하며, puromycin 선택 마커를 포함합니다. 장기적인 miRNA 억제 효과를 제공합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-10b-5p
디자인
- Tough Decoy (TuD)
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UACCCUGUAGAACCGAAUUUGUG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000221
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 목표 miRNA 억제 가능
- 다양한 세포 유형에 효율적 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기적인 억제 효과 제공
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



