CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-151-5p 억제를 위한 렌티바이러스 기반 microRNA inhibitor TuD(Tough Decoy) 디자인으로 강력하고 지속적인 miRNA 억제 가능 다양한 세포 유형에 효율적으로 전달되는 렌티바이러스 포맷 puromycin 저항성 유전자로 세포 선택 용이 −70°C 보관, 드라이아이스 배송

카탈로그번호
MLTUD0072
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0072 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

타깃 microRNA

  • mmu-miR-151-5p

디자인 방식

  • Tough Decoy (TuD) 기반 설계

제품 라인

  • MISSION®

품질 등급

제품 형태 및 농도

항목 내용
Form Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)

서열 정보

항목 내용
성숙 서열 UCGAGGAGCUCACAGUCUAGU
Sanger 성숙/소수 수납 번호 MIMAT0004536
microRNA 수납 번호 MI0000173

배송 및 보관

항목 내용
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables co-transfection with packaging plasmids to produce viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.

주요 특징

  • 강력한 miRNA 억제 효능
  • 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기적 억제 가능
  • puromycin 저항성 유전자로 안정적인 세포 선택 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.