
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 강력하고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 디자인 적용으로 효율적 발현 조절. 다양한 세포 유형에 안정적으로 전달 가능. Puromycin 선택 마커 및 WPRE 포함으로 발현 강화.
- 카탈로그번호
- MLTUD0060
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-142-3p
Tough Decoy (TuD) 디자인 적용
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGUAGUGUUUCCUACUUUAUGGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0000155 |
| microRNA 수납 번호 | MI0000167 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T, et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included for enhanced transgene expression.
The lentiviral vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과
- Lentiviral 전달 형식으로 다양한 세포에 효율적 적용
- 반복적인 transfection 없이 장기 억제 가능
- WPRE 및 puromycin 저항성 유전자 포함으로 발현 및 선택 효율 향상
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



