CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-874-3p를 표적하는 Lentiviral microRNA 억제제 Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제 가능 다양한 세포 유형에 효율적으로 전달되는 렌티바이러스 포맷 Puromycin 선택 마커와 WPRE 포함으로 안정적 발현 보장

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0734 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

  • mmu-miR-874-3p
  • 형태: Tough Decoy (TuD)

제품 라인

MISSION®

품질 등급

200 (M-Clarity Program)

제품 형태 및 사양

항목 내용
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CUGCCCUGGCCCGAGGGACCGA
Sanger 성숙/소수 수납 번호 MIMAT0004853
microRNA 수납 번호 MI0005479
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

  • 강력한 목표 miRNA 억제 효과
  • 렌티바이러스 포맷으로 다양한 세포 유형에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기 억제 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.