
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA Inhibitor, Mouse
상품 한눈에 보기
마우스 microRNA 억제를 위한 렌티바이러스 기반 TuD 디자인 인히비터. 효율적 전달과 장기적 억제 가능. TRC2-pLKO-puro 벡터 기반, 퓨로마이신 선택 가능. −70°C 보관, 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
카탈로그 번호 · 상품 설명출고판매가담기
ADADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기Merck MLTUD0180 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원
Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-30d-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, enabling co-transfection with compatible packaging plasmids to produce viral particles for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- Potent inhibition of desired miRNA
- Efficient lentiviral delivery into various cell types
- Enables long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CUUUCAGUCAGAUGUUUGCUGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0017011 |
| microRNA 수납 번호 | MI0000549 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



